Transcript: Human XM_011519514.2

PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 interacting protein (APBB1IP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APBB1IP (54518)
Length:
2582
CDS:
335..2191

Additional Resources:

NCBI RefSeq record:
XM_011519514.2
NBCI Gene record:
APBB1IP (54518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418097 TACTATGGGACTCAGCATAAA pLKO_005 1283 CDS 100% 13.200 18.480 N APBB1IP n/a
2 TRCN0000062544 CCACTGACTATTGCTTTGTTT pLKO.1 1320 CDS 100% 5.625 7.875 N APBB1IP n/a
3 TRCN0000062546 GCTAAGAACAAGGAATCCTTA pLKO.1 1208 CDS 100% 4.950 3.960 N APBB1IP n/a
4 TRCN0000425611 CATCTCTACAAGCATCAATTT pLKO_005 624 CDS 100% 13.200 9.240 N APBB1IP n/a
5 TRCN0000097781 GCACTGGAAGACCAAGATTTA pLKO.1 506 CDS 100% 13.200 9.240 N Apbb1ip n/a
6 TRCN0000062545 GCCACTGGTATCAGCCAATAT pLKO.1 686 CDS 100% 13.200 9.240 N APBB1IP n/a
7 TRCN0000062543 GCCCTGACATCTTGTTCATTT pLKO.1 2262 3UTR 100% 13.200 9.240 N APBB1IP n/a
8 TRCN0000062547 CCAGAATTTCTACTTGGATAA pLKO.1 1144 CDS 100% 10.800 6.480 N APBB1IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12050 pDONR223 100% 26.9% 24.1% None (many diffs) n/a
2 ccsbBroad304_12050 pLX_304 0% 26.9% 24.1% V5 (many diffs) n/a
3 TRCN0000474177 GACTGTGTCCTTCTGTCAGATTGT pLX_317 80% 26.9% 24.1% V5 (many diffs) n/a
Download CSV