Transcript: Human XM_011519829.3

PREDICTED: Homo sapiens tetraspanin 32 (TSPAN32), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN32 (10077)
Length:
1897
CDS:
27..596

Additional Resources:

NCBI RefSeq record:
XM_011519829.3
NBCI Gene record:
TSPAN32 (10077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373913 TTGGACCGCAAGGGCAAATAC pLKO_005 1032 3UTR 100% 13.200 18.480 N TSPAN32 n/a
2 TRCN0000184796 CACTCCGAAGCAGTTGCTATT pLKO.1 1813 3UTR 100% 10.800 8.640 N TSPAN32 n/a
3 TRCN0000154767 GCAGTTGCTATTGGTCCAAGA pLKO.1 1822 3UTR 100% 4.050 3.240 N TSPAN32 n/a
4 TRCN0000153238 GTATATGAGCAGGCGATGAAA pLKO.1 519 CDS 100% 5.625 3.938 N TSPAN32 n/a
5 TRCN0000373912 ATGGTGACTCTTACCTACTTC pLKO_005 222 CDS 100% 4.950 3.465 N TSPAN32 n/a
6 TRCN0000373828 GCTGGTCACCTGCTTCTTTAT pLKO_005 173 CDS 100% 13.200 7.920 N TSPAN32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14037 pDONR223 100% 52.4% 44.1% None (many diffs) n/a
2 ccsbBroad304_14037 pLX_304 0% 52.4% 44.1% V5 (many diffs) n/a
3 TRCN0000478375 CCCCGTCGCAAGCAACGATCCACC pLX_317 43.1% 52.4% 44.1% V5 (many diffs) n/a
Download CSV