Transcript: Human XM_011519904.2

PREDICTED: Homo sapiens synaptotagmin 9 (SYT9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT9 (143425)
Length:
2015
CDS:
216..1694

Additional Resources:

NCBI RefSeq record:
XM_011519904.2
NBCI Gene record:
SYT9 (143425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381099 ACAACGAAGCCATAGTCTTTG pLKO_005 1471 CDS 100% 10.800 15.120 N SYT9 n/a
2 TRCN0000054236 GCGTGTCTCTCTTCGTATCTT pLKO.1 418 CDS 100% 5.625 4.500 N SYT9 n/a
3 TRCN0000054234 CCTGTTTACAACGAAGCCATA pLKO.1 1464 CDS 100% 4.050 3.240 N SYT9 n/a
4 TRCN0000382059 GGCTGACCATTACCATTATAA pLKO_005 1318 CDS 100% 15.000 10.500 N SYT9 n/a
5 TRCN0000380801 CCTTATGTCAAGATCTATTTG pLKO_005 987 CDS 100% 13.200 9.240 N SYT9 n/a
6 TRCN0000381053 ACTTCTCTGTGTACGACTTTG pLKO_005 1126 CDS 100% 10.800 7.560 N SYT9 n/a
7 TRCN0000381574 TATTTCCGGTTCCCTACAATG pLKO_005 1084 CDS 100% 10.800 7.560 N SYT9 n/a
8 TRCN0000054237 CCACTTGTCCATAGCAGTCAT pLKO.1 1520 CDS 100% 4.950 3.465 N SYT9 n/a
9 TRCN0000054233 CCCGGCATAATTCAATCCGAA pLKO.1 709 CDS 100% 2.640 1.848 N SYT9 n/a
10 TRCN0000054235 CTGGAGTGAAATGTTGTCATA pLKO.1 1622 CDS 100% 4.950 2.970 N SYT9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04964 pDONR223 100% 99.1% 99.3% None 351T>C;1467_1468insAAAC;1469_1476delCTCATGGGinsA n/a
2 ccsbBroad304_04964 pLX_304 0% 99.1% 99.3% V5 351T>C;1467_1468insAAAC;1469_1476delCTCATGGGinsA n/a
3 TRCN0000491923 TTACTCCAGGGGGTACAGAGTTTT pLX_317 26.7% 99.1% 99.3% V5 351T>C;1467_1468insAAAC;1469_1476delCTCATGGGinsA n/a
Download CSV