Transcript: Human XM_011519906.2

PREDICTED: Homo sapiens synaptotagmin 9 (SYT9), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT9 (143425)
Length:
5455
CDS:
216..1271

Additional Resources:

NCBI RefSeq record:
XM_011519906.2
NBCI Gene record:
SYT9 (143425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054236 GCGTGTCTCTCTTCGTATCTT pLKO.1 418 CDS 100% 5.625 4.500 N SYT9 n/a
2 TRCN0000380801 CCTTATGTCAAGATCTATTTG pLKO_005 987 CDS 100% 13.200 9.240 N SYT9 n/a
3 TRCN0000381053 ACTTCTCTGTGTACGACTTTG pLKO_005 1126 CDS 100% 10.800 7.560 N SYT9 n/a
4 TRCN0000381574 TATTTCCGGTTCCCTACAATG pLKO_005 1084 CDS 100% 10.800 7.560 N SYT9 n/a
5 TRCN0000054233 CCCGGCATAATTCAATCCGAA pLKO.1 709 CDS 100% 2.640 1.848 N SYT9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04964 pDONR223 100% 71.2% 70.8% None (many diffs) n/a
2 ccsbBroad304_04964 pLX_304 0% 71.2% 70.8% V5 (many diffs) n/a
3 TRCN0000491923 TTACTCCAGGGGGTACAGAGTTTT pLX_317 26.7% 71.2% 70.8% V5 (many diffs) n/a
Download CSV