Transcript: Human XM_011520100.1

PREDICTED: Homo sapiens LIM domain only 1 (LMO1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMO1 (4004)
Length:
693
CDS:
18..386

Additional Resources:

NCBI RefSeq record:
XM_011520100.1
NBCI Gene record:
LMO1 (4004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232092 CGCTCTCCTGCCACATTAGAA pLKO_005 485 3UTR 100% 5.625 7.875 N LMO1 n/a
2 TRCN0000015047 CAGCTCTGCAACCAGAGATTT pLKO.1 264 CDS 100% 1.320 1.848 N LMO1 n/a
3 TRCN0000015043 GCCACATTAGAACTTCTCCGT pLKO.1 494 3UTR 100% 0.660 0.924 N LMO1 n/a
4 TRCN0000232090 ATGAGGAAGGGCAGCTCAATG pLKO_005 340 CDS 100% 10.800 7.560 N LMO1 n/a
5 TRCN0000015046 CAGCTCAATGGCACCTTTGAA pLKO.1 351 CDS 100% 5.625 3.938 N LMO1 n/a
6 TRCN0000015044 CAACATGATCTTGTGTCAGAT pLKO.1 314 CDS 100% 4.950 3.465 N LMO1 n/a
7 TRCN0000232089 CAACATGATCTTGTGTCAGAT pLKO_005 314 CDS 100% 4.950 3.465 N LMO1 n/a
8 TRCN0000232091 CACCTTTGAATCCCAAGTTCA pLKO_005 362 CDS 100% 4.950 3.465 N LMO1 n/a
9 TRCN0000054567 CCTGAAGAACAACATGATCTT pLKO.1 305 CDS 100% 4.950 2.970 N Lmo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06530 pDONR223 100% 67.6% 55.4% None (many diffs) n/a
2 ccsbBroad304_06530 pLX_304 0% 67.6% 55.4% V5 (many diffs) n/a
3 TRCN0000473676 TTTATAGTACTATCGAGGGAACTC pLX_317 98.7% 67.6% 55.4% V5 (many diffs) n/a
Download CSV