Transcript: Human XM_011520459.3

PREDICTED: Homo sapiens tetraspanin 18 (TSPAN18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN18 (90139)
Length:
4284
CDS:
398..1144

Additional Resources:

NCBI RefSeq record:
XM_011520459.3
NBCI Gene record:
TSPAN18 (90139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520459.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380534 ACTCGGTCATGATCACATTTG pLKO_005 813 CDS 100% 10.800 15.120 N TSPAN18 n/a
2 TRCN0000381462 GCTGTTACACGGTGATCCTCA pLKO_005 1014 CDS 100% 2.640 3.696 N TSPAN18 n/a
3 TRCN0000119219 GCAGGGCTGTTACACGGTGAT pLKO.1 1009 CDS 100% 1.350 1.890 N TSPAN18 n/a
4 TRCN0000380333 GTCCGTGAGAACAAGTGTCTG pLKO_005 626 CDS 100% 4.050 3.240 N TSPAN18 n/a
5 TRCN0000380023 TGCATCTGTGTTTCGACTCCT pLKO_005 871 CDS 100% 2.640 2.112 N TSPAN18 n/a
6 TRCN0000382302 GAAGTATCTGATGTTTGTATT pLKO_005 424 CDS 100% 13.200 9.240 N TSPAN18 n/a
7 TRCN0000119217 CCACAAGTATTCAGTTCTCAA pLKO.1 2565 3UTR 100% 4.950 3.465 N TSPAN18 n/a
8 TRCN0000119218 CTGAAGACTTTAAGTTTGCAT pLKO.1 855 CDS 100% 3.000 2.100 N TSPAN18 n/a
9 TRCN0000119220 CCGAGAATTCTTCACCAAGGA pLKO.1 736 CDS 100% 0.000 0.000 N TSPAN18 n/a
10 TRCN0000381992 AGCCATCCTGGCCTTCATCTT pLKO_005 700 CDS 100% 4.950 2.970 N TSPAN18 n/a
11 TRCN0000119221 CACCCGAGAATTCTTCACCAA pLKO.1 733 CDS 100% 0.000 0.000 N TSPAN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520459.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12933 pDONR223 100% 91.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_12933 pLX_304 0% 91.1% 87.6% V5 (many diffs) n/a
3 TRCN0000479662 ATGCGTACCTCTTTGCTGCATACC pLX_317 50.3% 91.1% 87.6% V5 (many diffs) n/a
Download CSV