Transcript: Human XM_011520624.2

PREDICTED: Homo sapiens G protein-coupled receptor 19 (GPR19), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR19 (2842)
Length:
3268
CDS:
454..1758

Additional Resources:

NCBI RefSeq record:
XM_011520624.2
NBCI Gene record:
GPR19 (2842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005611 CGTGCAAGGTTGTGCGATATT pLKO.1 920 CDS 100% 13.200 18.480 N GPR19 n/a
2 TRCN0000005614 GCTTGGCCCATTAACTCAAAT pLKO.1 1717 CDS 100% 13.200 18.480 N GPR19 n/a
3 TRCN0000356402 ACGTGCAAGGTTGTGCGATAT pLKO_005 919 CDS 100% 10.800 15.120 N GPR19 n/a
4 TRCN0000356331 TTACCGAAGCAATGCCTATAC pLKO_005 1566 CDS 100% 10.800 15.120 N GPR19 n/a
5 TRCN0000005612 CCGAAGCAATGCCTATACTAT pLKO.1 1569 CDS 100% 5.625 7.875 N GPR19 n/a
6 TRCN0000005613 CGGTTCTACACCATCGTCTAT pLKO.1 997 CDS 100% 4.950 6.930 N GPR19 n/a
7 TRCN0000005610 CCTCTATGAAATGTTACCGAA pLKO.1 1553 CDS 100% 2.640 1.848 N GPR19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487692 AAAGTACCAAGCGGCCGTTTACCG pLX_317 21.8% 95.4% 95.3% V5 (not translated due to prior stop codon) 1_57del;622G>A;1137C>T n/a
2 TRCN0000487695 GAATTTATTGACATATCTATAATT pLX_317 21.8% 95.4% 95.3% V5 (not translated due to prior stop codon) 1_57del;622G>A;897T>C n/a
3 TRCN0000488209 ACGTATTACATCCCTGAGGGAATT pLX_317 29.4% 95.1% 94.9% V5 (many diffs) n/a
Download CSV