Transcript: Human XM_011520736.1

PREDICTED: Homo sapiens serine/threonine/tyrosine kinase 1 (STYK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STYK1 (55359)
Length:
2814
CDS:
325..1593

Additional Resources:

NCBI RefSeq record:
XM_011520736.1
NBCI Gene record:
STYK1 (55359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146987 GAAAAACAAGTATATCACAT pXPR_003 CGG 689 54% 8 0.6875 STYK1 STYK1 75697
2 BRDN0001145785 TCGAGCCAATATGAACACTG pXPR_003 GGG 403 32% 6 0.3441 STYK1 STYK1 75695
3 BRDN0001146810 AAAGTTTGAGCTTTACCTTG pXPR_003 AGG 186 15% 5 -0.6741 STYK1 STYK1 75696
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196595 GCGAATCCAATTCCATCAATA pLKO.1 813 CDS 100% 13.200 18.480 N STYK1 n/a
2 TRCN0000273453 ACATTCATGCATGAGTATATG pLKO_005 1611 3UTR 100% 13.200 10.560 N STYK1 n/a
3 TRCN0000001744 CGGGATGTGATGACTATGGAT pLKO.1 955 CDS 100% 3.000 2.400 N STYK1 n/a
4 TRCN0000001746 CGCCTAGAAGCTGCCATTAAA pLKO.1 1459 CDS 100% 15.000 10.500 N STYK1 n/a
5 TRCN0000196658 GAAGCAGTATGAAGTGATTAT pLKO.1 387 CDS 100% 13.200 9.240 N STYK1 n/a
6 TRCN0000273396 GCCCATCTTTCGAGCCAATAT pLKO_005 702 CDS 100% 13.200 9.240 N STYK1 n/a
7 TRCN0000001742 AGTGTTATTCTCAAGGCTTTA pLKO.1 751 CDS 100% 10.800 7.560 N STYK1 n/a
8 TRCN0000195207 CCAACTTTGTTGGTTACTATC pLKO.1 412 CDS 100% 10.800 7.560 N STYK1 n/a
9 TRCN0000273393 CCAACTTTGTTGGTTACTATC pLKO_005 412 CDS 100% 10.800 7.560 N STYK1 n/a
10 TRCN0000273452 GGCCATCTCCTCTACTCAAAC pLKO_005 1164 CDS 100% 10.800 7.560 N STYK1 n/a
11 TRCN0000195740 CAAGTATATCACATCGGAAAG pLKO.1 1003 CDS 100% 6.000 4.200 N STYK1 n/a
12 TRCN0000273394 CAAGTATATCACATCGGAAAG pLKO_005 1003 CDS 100% 6.000 4.200 N STYK1 n/a
13 TRCN0000001743 GTTGGTTACTATCTTCCTCAT pLKO.1 420 CDS 100% 4.050 2.835 N STYK1 n/a
14 TRCN0000001745 CAGGGACACAAAGGGAGAAAT pLKO.1 1674 3UTR 100% 13.200 7.920 N STYK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15097 pDONR223 0% 99.9% 99.7% None 610A>G n/a
2 ccsbBroad304_15097 pLX_304 0% 99.9% 99.7% V5 610A>G n/a
3 TRCN0000472344 CCGCGCCCAACAGTTGCCTGCCCA pLX_317 31.5% 99.4% 99.2% V5 610A>G;1261_1266delATGCTT n/a
4 TRCN0000488302 AACGATAATTTATTCACATACAGT pLX_317 26% 99.9% 100% V5 (not translated due to prior stop codon) 366T>C n/a
5 TRCN0000491962 TCCGGACCTCAACCCTCATCCCAC pLX_317 26.3% 99.9% 99.7% V5 (not translated due to prior stop codon) 610A>G n/a
6 TRCN0000491916 CCAAAACTCCAATTATGGTCAGGG pLX_317 26.2% 99.8% 99.5% V5 610A>G;1266_1267insG n/a
7 TRCN0000488850 ATCCACCTTAGTTCCTAACAACCG pLX_317 28.7% 99.8% 99.7% V5 366T>C;1266_1267insG n/a
Download CSV