Transcript: Human XM_011520748.3

PREDICTED: Homo sapiens fatty acyl-CoA reductase 2 (FAR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAR2 (55711)
Length:
5211
CDS:
994..2466

Additional Resources:

NCBI RefSeq record:
XM_011520748.3
NBCI Gene record:
FAR2 (55711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123279 CCTTGCGTATTAAACGTGAAA pLKO.1 3638 3UTR 100% 4.950 6.930 N FAR2 n/a
2 TRCN0000123280 CCTCTTTAATACTGCCCTCTT pLKO.1 3244 3UTR 100% 4.050 3.240 N FAR2 n/a
3 TRCN0000123281 CATGAGAAGATCAGAGCTATT pLKO.1 1279 CDS 100% 10.800 7.560 N FAR2 n/a
4 TRCN0000123282 CCACATTACATCTGGTAACAT pLKO.1 1962 CDS 100% 5.625 3.938 N FAR2 n/a
5 TRCN0000123283 CGATGCTATTATTGACGAGAT pLKO.1 1608 CDS 100% 4.050 2.835 N FAR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03636 pDONR223 100% 87.6% 85.4% None (many diffs) n/a
2 ccsbBroad304_03636 pLX_304 0% 87.6% 85.4% V5 (many diffs) n/a
3 TRCN0000480027 TGGCAGCCGGTCCTCCTTCGACCC pLX_317 25.6% 87.6% 85.4% V5 (many diffs) n/a
Download CSV