Transcript: Human XM_011520820.3

PREDICTED: Homo sapiens solute carrier organic anion transporter family member 1A2 (SLCO1A2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLCO1A2 (6579)
Length:
7547
CDS:
1626..3632

Additional Resources:

NCBI RefSeq record:
XM_011520820.3
NBCI Gene record:
SLCO1A2 (6579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413590 TACGTCCTAGTAGGCAATATT pLKO_005 2097 CDS 100% 15.000 21.000 N SLCO1A2 n/a
2 TRCN0000043084 GCAATCTTTCTAATGGGTATT pLKO.1 2679 CDS 100% 10.800 15.120 N SLCO1A2 n/a
3 TRCN0000426688 CCCTTAATTCATCGAAGTAAG pLKO_005 3895 3UTR 100% 10.800 8.640 N SLCO1A2 n/a
4 TRCN0000043085 GCTTTGAGATTGGAAATCTTT pLKO.1 1810 CDS 100% 5.625 3.938 N SLCO1A2 n/a
5 TRCN0000043083 GCTTGTAGAAACAGGAGCTAT pLKO.1 2210 CDS 100% 4.950 3.465 N SLCO1A2 n/a
6 TRCN0000043087 CCAAGATGTTTCTGTTGGCAA pLKO.1 1675 CDS 100% 2.640 1.848 N SLCO1A2 n/a
7 TRCN0000043086 GCTGTATTCAAACATCAGGAA pLKO.1 3073 CDS 100% 2.640 1.848 N SLCO1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487728 GTGGCAAAGGTCACCACTGCAATC pLX_317 13.8% 97.9% 96.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11141 pDONR223 100% 60.9% 60.9% None (many diffs) n/a
3 ccsbBroad304_11141 pLX_304 0% 60.9% 60.9% V5 (many diffs) n/a
Download CSV