Transcript: Human XM_011521057.3

PREDICTED: Homo sapiens glypican 5 (GPC5), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPC5 (2262)
Length:
3329
CDS:
361..1695

Additional Resources:

NCBI RefSeq record:
XM_011521057.3
NBCI Gene record:
GPC5 (2262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147200 CGGATGTTAATCCTGAAGAAT pLKO.1 824 CDS 100% 5.625 7.875 N GPC5 n/a
2 TRCN0000378703 GTGAGTCCATTTGGTAATATT pLKO_005 961 CDS 100% 15.000 10.500 N GPC5 n/a
3 TRCN0000109542 GCGAAGAAGTTCGGAAACTTT pLKO.1 449 CDS 100% 0.563 0.394 N Gpc5 n/a
4 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3154 3UTR 100% 4.950 2.475 Y ORAI2 n/a
5 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3144 3UTR 100% 13.200 6.600 Y IQCC n/a
6 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3151 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00562 pDONR223 100% 76.5% 75% None (many diffs) n/a
2 ccsbBroad304_00562 pLX_304 0% 76.5% 75% V5 (many diffs) n/a
3 TRCN0000465883 CTCAAGAGTACCAACAATTCGGTT pLX_317 17.9% 76.5% 75% V5 (many diffs) n/a
Download CSV