Transcript: Human XM_011521274.2

PREDICTED: Homo sapiens codanin 1 (CDAN1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDAN1 (146059)
Length:
3716
CDS:
112..2787

Additional Resources:

NCBI RefSeq record:
XM_011521274.2
NBCI Gene record:
CDAN1 (146059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083532 CCACCTCATCTCCGAGATAAA pLKO.1 2178 CDS 100% 13.200 18.480 N CDAN1 n/a
2 TRCN0000083529 GCTGGAATATTACCGGGACAT pLKO.1 1230 CDS 100% 4.050 5.670 N CDAN1 n/a
3 TRCN0000083530 CCTCCTCGTTGCAGATCAAAT pLKO.1 2364 CDS 100% 13.200 10.560 N CDAN1 n/a
4 TRCN0000431837 GAATCTTGGGAGTCTACATTT pLKO_005 3199 3UTR 100% 13.200 9.240 N CDAN1 n/a
5 TRCN0000419835 TGATCAGGAGGGAGGTGAAAG pLKO_005 2054 CDS 100% 10.800 7.560 N CDAN1 n/a
6 TRCN0000083528 CCTGCTTAACTTATGAAGAAA pLKO.1 3168 3UTR 100% 5.625 3.938 N CDAN1 n/a
7 TRCN0000083531 CCTTGTTTACTCCTCGTGCAT pLKO.1 68 5UTR 100% 2.640 1.848 N CDAN1 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3289 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09624 pDONR223 100% 72.5% 72.4% None 0_1ins1008;254C>T;1309T>N n/a
2 ccsbBroad304_09624 pLX_304 0% 72.5% 72.4% V5 0_1ins1008;254C>T;1309T>N n/a
3 TRCN0000480914 TTACTAAAATTAAGAAAAATACCC pLX_317 10.8% 72.5% 72.4% V5 (not translated due to frame shift) 0_1ins1008;254C>T;1309T>N n/a
Download CSV