Transcript: Human XM_011521283.2

PREDICTED: Homo sapiens TBC1 domain family member 21 (TBC1D21), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D21 (161514)
Length:
1222
CDS:
154..1161

Additional Resources:

NCBI RefSeq record:
XM_011521283.2
NBCI Gene record:
TBC1D21 (161514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150365 CAATAACATTGCACGTGACAT pLKO.1 510 CDS 100% 4.950 6.930 N TBC1D21 n/a
2 TRCN0000428487 CTACAAGGCCTTATGCCAAAT pLKO_005 432 CDS 100% 10.800 8.640 N TBC1D21 n/a
3 TRCN0000152433 CACGGGACTTCATTTGTGTTA pLKO.1 287 CDS 100% 4.950 3.960 N TBC1D21 n/a
4 TRCN0000152496 CTTCACAGAGACTCGCAATAA pLKO.1 495 CDS 100% 13.200 9.240 N TBC1D21 n/a
5 TRCN0000413532 ACCCATTGACAAGACAGAATG pLKO_005 228 CDS 100% 10.800 7.560 N TBC1D21 n/a
6 TRCN0000157377 CGTGTTTGCTGAGCACCTAAA pLKO.1 810 CDS 100% 10.800 7.560 N TBC1D21 n/a
7 TRCN0000157431 GCCTTCAAGTCCTTCGATGAT pLKO.1 892 CDS 100% 4.950 3.465 N TBC1D21 n/a
8 TRCN0000152734 CCATGAGATGATGATGCTCTT pLKO.1 648 CDS 100% 4.050 2.835 N TBC1D21 n/a
9 TRCN0000158236 CAAGACAGAATGGGACAGCTT pLKO.1 237 CDS 100% 2.640 1.848 N TBC1D21 n/a
10 TRCN0000156340 CCAAGAACCTAGACATGCTCA pLKO.1 764 CDS 100% 2.640 1.848 N TBC1D21 n/a
11 TRCN0000419965 TGAGGACTGAAGCCTGGAAAT pLKO_005 338 CDS 100% 10.800 6.480 N TBC1D21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05111 pDONR223 100% 98.2% 97% None (many diffs) n/a
2 ccsbBroad304_05111 pLX_304 0% 98.2% 97% V5 (many diffs) n/a
3 TRCN0000476155 AAACCCATGAGCAGATGGACCGCA pLX_317 34.7% 98.2% 97% V5 (many diffs) n/a
Download CSV