Transcript: Human XM_011521302.2

PREDICTED: Homo sapiens exonuclease 3'-5' domain containing 1 (EXD1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXD1 (161829)
Length:
2542
CDS:
245..1354

Additional Resources:

NCBI RefSeq record:
XM_011521302.2
NBCI Gene record:
EXD1 (161829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322718 GGCCACAAATTGCCGAGTTTA pLKO_005 172 5UTR 100% 13.200 18.480 N EXD1 n/a
2 TRCN0000051402 GAACACTTTATGACACCCAAA pLKO.1 1091 CDS 100% 4.050 5.670 N EXD1 n/a
3 TRCN0000322719 CCTGGTGGATGGTTACCTAAA pLKO_005 628 CDS 100% 10.800 8.640 N EXD1 n/a
4 TRCN0000322777 CATGTTGTAAATGTAGTAATG pLKO_005 1435 3UTR 100% 10.800 7.560 N EXD1 n/a
5 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 2235 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05114 pDONR223 100% 71.6% 71.7% None 0_1ins435;759A>G;774C>T n/a
2 ccsbBroad304_05114 pLX_304 0% 71.6% 71.7% V5 0_1ins435;759A>G;774C>T n/a
3 TRCN0000479647 GAGGACTTATGCGCACCTGCCCGG pLX_317 23.4% 71.6% 71.7% V5 0_1ins435;759A>G;774C>T n/a
Download CSV