Transcript: Human XM_011521473.1

PREDICTED: Homo sapiens alanyl aminopeptidase, membrane (ANPEP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANPEP (290)
Length:
3801
CDS:
444..3347

Additional Resources:

NCBI RefSeq record:
XM_011521473.1
NBCI Gene record:
ANPEP (290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050239 CCTCAATGTGACGGGCTATTA pLKO.1 2312 CDS 100% 13.200 18.480 N ANPEP n/a
2 TRCN0000435991 GACGATTCTCCACCGAGTATG pLKO_005 3163 CDS 100% 10.800 15.120 N ANPEP n/a
3 TRCN0000418482 ACCAGTACAGCGAGGTTAATG pLKO_005 2689 CDS 100% 13.200 10.560 N ANPEP n/a
4 TRCN0000425830 GCATTACCAACAACGTCATTG pLKO_005 3037 CDS 100% 10.800 7.560 N ANPEP n/a
5 TRCN0000050241 CCACAGCAAGAAGCTCAACTA pLKO.1 809 CDS 100% 4.950 3.465 N ANPEP n/a
6 TRCN0000050238 CCCTCTTCATTCACTTCAGAA pLKO.1 2626 CDS 100% 4.950 3.465 N ANPEP n/a
7 TRCN0000050242 GTGACCATAGAGTGGTGGAAT pLKO.1 1638 CDS 100% 4.950 3.465 N ANPEP n/a
8 TRCN0000050240 CCTGAGCTACTTCAAGCTCAT pLKO.1 2546 CDS 100% 0.405 0.284 N ANPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05817 pDONR223 100% 99.9% 100% None 2136C>A;2178C>A n/a
2 ccsbBroad304_05817 pLX_304 0% 99.9% 100% V5 2136C>A;2178C>A n/a
3 TRCN0000476147 CCCAATGTTAGAGCAAGGAATAGG pLX_317 12.9% 99.9% 100% V5 2136C>A;2178C>A n/a
Download CSV