Transcript: Human XM_011521856.2

PREDICTED: Homo sapiens RAB27A, member RAS oncogene family (RAB27A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB27A (5873)
Length:
3332
CDS:
126..791

Additional Resources:

NCBI RefSeq record:
XM_011521856.2
NBCI Gene record:
RAB27A (5873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005298 CAGGAGAGGTTTCGTAGCTTA pLKO.1 357 CDS 100% 4.950 6.930 N RAB27A n/a
2 TRCN0000297751 CAGGAGAGGTTTCGTAGCTTA pLKO_005 357 CDS 100% 4.950 6.930 N RAB27A n/a
3 TRCN0000380306 GATCTTCTCTATGATTGATAC pLKO_005 836 3UTR 100% 10.800 8.640 N RAB27A n/a
4 TRCN0000005295 CCAGTGTACTTTACCAATATA pLKO.1 193 CDS 100% 15.000 10.500 N RAB27A n/a
5 TRCN0000279985 CCAGTGTACTTTACCAATATA pLKO_005 193 CDS 100% 15.000 10.500 N RAB27A n/a
6 TRCN0000380256 CACAACAGTGGGCATTGATTT pLKO_005 242 CDS 100% 13.200 9.240 N RAB27A n/a
7 TRCN0000005294 CCTGTGCATTTGAATTGTATA pLKO.1 2515 3UTR 100% 13.200 9.240 N RAB27A n/a
8 TRCN0000380034 GAAGGAGTGGTGCGATCAAAT pLKO_005 711 CDS 100% 13.200 9.240 N RAB27A n/a
9 TRCN0000379740 AGGAGAGGTTTCGTAGCTTAA pLKO_005 358 CDS 100% 10.800 7.560 N Rab27a n/a
10 TRCN0000005296 CGGATCAGTTAAGTGAAGAAA pLKO.1 745 CDS 100% 5.625 3.938 N RAB27A n/a
11 TRCN0000279982 CGGATCAGTTAAGTGAAGAAA pLKO_005 745 CDS 100% 5.625 3.938 N RAB27A n/a
12 TRCN0000005297 GCTGCCAATGGGACAAACATA pLKO.1 615 CDS 100% 5.625 3.375 N RAB27A n/a
13 TRCN0000280049 GCTGCCAATGGGACAAACATA pLKO_005 615 CDS 100% 5.625 3.375 N RAB27A n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2596 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2596 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2594 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2594 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2594 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01361 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01361 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469786 TTTAGGCAAAAAATAACACCATGA pLX_317 56.1% 100% 100% V5 n/a
Download CSV