Transcript: Human XM_011521857.2

PREDICTED: Homo sapiens RAD51 recombinase (RAD51), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAD51 (5888)
Length:
2049
CDS:
50..1069

Additional Resources:

NCBI RefSeq record:
XM_011521857.2
NBCI Gene record:
RAD51 (5888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329688 TTAGAGCAGTGTGGCATAAAT pLKO_005 131 CDS 100% 15.000 21.000 N RAD51 n/a
2 TRCN0000018878 CCACAACCCATTTCACGGTTA pLKO.1 113 CDS 100% 4.050 5.670 N RAD51 n/a
3 TRCN0000018879 CGGTCAGAGATCATACAGATT pLKO.1 335 CDS 100% 4.950 3.960 N RAD51 n/a
4 TRCN0000329686 CGGTCAGAGATCATACAGATT pLKO_005 335 CDS 100% 4.950 3.960 N RAD51 n/a
5 TRCN0000018875 GCTAAGACTAACTCAAGATAA pLKO.1 1645 3UTR 100% 13.200 9.240 N RAD51 n/a
6 TRCN0000018876 CGCCCTTTACAGAACAGACTA pLKO.1 724 CDS 100% 4.950 3.465 N RAD51 n/a
7 TRCN0000329687 CGCCCTTTACAGAACAGACTA pLKO_005 724 CDS 100% 4.950 3.465 N RAD51 n/a
8 TRCN0000018877 GCTGAAGCTATGTTCGCCATT pLKO.1 1016 CDS 100% 4.050 2.835 N RAD51 n/a
9 TRCN0000353568 GCTGAAGCTATGTTCGCCATT pLKO_005 1016 CDS 100% 4.050 2.835 N RAD51 n/a
10 TRCN0000012660 CGGTCAGAGATCATACAGATA pLKO.1 335 CDS 100% 4.950 3.960 N Rad51 n/a
11 TRCN0000319742 CGGTCAGAGATCATACAGATA pLKO_005 335 CDS 100% 4.950 3.960 N Rad51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11086 pDONR223 100% 71.3% 71.3% None 223_513del n/a
2 ccsbBroad304_11086 pLX_304 0% 71.3% 71.3% V5 223_513del n/a
3 TRCN0000475891 GTATCTATCATTCAAGGGACCTAG pLX_317 49.3% 71.3% 71.3% V5 223_513del n/a
Download CSV