Construct: ORF TRCN0000475891
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008311.1_s317c1
- Derived from:
- ccsbBroadEn_11086
- DNA Barcode:
- GTATCTATCATTCAAGGGACCTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD51 (5888)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475891
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521862.3 | 80.6% | 70.3% | (many diffs) |
| 2 | human | 5888 | RAD51 | RAD51 recombinase | NM_002875.5 | 71.3% | 71.3% | 223_513del |
| 3 | human | 5888 | RAD51 | RAD51 recombinase | XM_006720626.3 | 71.3% | 71.3% | 223_513del |
| 4 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521857.2 | 71.3% | 71.3% | 223_513del |
| 5 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521858.2 | 71.3% | 71.3% | 223_513del |
| 6 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521859.2 | 71.3% | 71.3% | 223_513del |
| 7 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521860.2 | 71.3% | 71.3% | 223_513del |
| 8 | human | 5888 | RAD51 | RAD51 recombinase | NM_001164269.2 | 71.1% | 71.1% | 223_516del |
| 9 | human | 5888 | RAD51 | RAD51 recombinase | NM_133487.4 | 71.1% | 71.1% | 223_516del |
| 10 | human | 5888 | RAD51 | RAD51 recombinase | NM_001164270.2 | 53.9% | 45.7% | 223_513del;772_773ins122;840_841ins55 |
| 11 | human | 5888 | RAD51 | RAD51 recombinase | XM_011521861.2 | 53.9% | 45.7% | 223_513del;772_773ins122;840_841ins55 |
| 12 | mouse | 19361 | Rad51 | RAD51 recombinase | NM_011234.4 | 65% | 70.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 792
- ORF length:
- 726
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aatgcagatg cagcttgaag caaatgcaga tacttcagtg gaagaagaaa 121 gctttggccc acaacccatt tcacggttag agcagtgtgg cataaatgcc aacgatgtga 181 agaaattgga agaagctgga ttccatactg tggaggctgt tgcctatgcg ccaaagaagg 241 agctaataaa tattaaggga attagtgaag ccaaagctga taaaattctg gcagtggctg 301 agaggtatgg tctctctggc agtgatgtcc tggataatgt agcatatgct cgagcgttca 361 acacagacca ccagacccag ctcctttatc aagcatcagc catgatggta gaatctaggt 421 atgcactgct tattGTAGAC AGTGCCACCG CCCTTTACAG AACAGACTAC TCGGGTCGAG 481 GTGAGCTTTC AGCCAGGCAG ATGCACTTGG CCAGGTTTCT GCGGATGCTT CTGCGACTCG 541 CTGATGAGTT TGGTGTAGCA GTGGTAATCA CTAATCAGGT GGTAGCTCAA GTGGATGGAG 601 CAGCGATGTT TGCTGCTGAT CCCAAAAAAC CTATTGGAGG AAATATCATC GCCCATGCAT 661 CAACAACCAG ATTGTATCTG AGGAAAGGAA GAGGGGAAAC CAGAATCTGC AAAATCTACG 721 ACTCTCCCTG TCTTCCTGAA GCTGAAGCTA TGTTCGCCAT TAATGCAGAT GGAGTGGGAG 781 ATGCCAAAGA CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 841 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 901 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGTA TCTATCATTC AAGGGACCTA 961 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t