Transcript: Human XM_011521906.2

PREDICTED: Homo sapiens CREB regulated transcription coactivator 3 (CRTC3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRTC3 (64784)
Length:
5123
CDS:
158..1918

Additional Resources:

NCBI RefSeq record:
XM_011521906.2
NBCI Gene record:
CRTC3 (64784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123186 CGCTCAATAAGACTGTGCTTT pLKO.1 1065 CDS 100% 4.950 3.960 N CRTC3 n/a
2 TRCN0000298595 TATGACCCACCTGGGTATAAG pLKO_005 994 CDS 100% 13.200 9.240 N CRTC3 n/a
3 TRCN0000123187 CCCATCTCTTTCCACCACAAA pLKO.1 1171 CDS 100% 4.950 3.465 N CRTC3 n/a
4 TRCN0000286389 CCCATCTCTTTCCACCACAAA pLKO_005 1171 CDS 100% 4.950 3.465 N CRTC3 n/a
5 TRCN0000123185 CCCTCTGTTGAAGAGACGTTT pLKO.1 1880 CDS 100% 4.950 3.465 N CRTC3 n/a
6 TRCN0000123184 GCAGTGGAACAGAAGAATGTT pLKO.1 1926 3UTR 100% 5.625 3.375 N CRTC3 n/a
7 TRCN0000298213 GCAGTGGAACAGAAGAATGTT pLKO_005 1926 3UTR 100% 5.625 3.375 N CRTC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12493 pDONR223 100% 54.6% 54.6% None 1_798del n/a
2 ccsbBroad304_12493 pLX_304 0% 54.6% 54.6% V5 1_798del n/a
3 TRCN0000476218 TTTTGCCTTGAAACTGAACATGGA pLX_317 31.8% 54.6% 54.6% V5 1_798del n/a
Download CSV