Transcript: Human XM_011522077.2

PREDICTED: Homo sapiens semaphorin 6D (SEMA6D), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA6D (80031)
Length:
5946
CDS:
346..3510

Additional Resources:

NCBI RefSeq record:
XM_011522077.2
NBCI Gene record:
SEMA6D (80031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063209 CCCGGATGAAACTCTGTCATT pLKO.1 1500 CDS 100% 4.950 6.930 N SEMA6D n/a
2 TRCN0000112328 GCCATAGAATATGGAAACTAT pLKO.1 1021 CDS 100% 5.625 4.500 N Sema6d n/a
3 TRCN0000063212 GCAGTCTATTACAGACATAAT pLKO.1 1236 CDS 100% 13.200 9.240 N SEMA6D n/a
4 TRCN0000450080 GGATCTGCCCTTCGCACAATA pLKO_005 958 CDS 100% 13.200 9.240 N Sema6d n/a
5 TRCN0000063211 GCCAAACTGAATGGTCTCTTT pLKO.1 2431 CDS 100% 4.950 3.465 N SEMA6D n/a
6 TRCN0000063210 GCCACAACTTTATCAAAGTAT pLKO.1 698 CDS 100% 5.625 3.375 N SEMA6D n/a
7 TRCN0000063208 GCCCATTTGATGCCAGACAAA pLKO.1 842 CDS 100% 4.950 2.970 N SEMA6D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04171 pDONR223 100% 93.5% 93.5% None 1646_1647ins39;1708_1875del n/a
2 ccsbBroad304_04171 pLX_304 0% 93.5% 93.5% V5 1646_1647ins39;1708_1875del n/a
3 TRCN0000475909 ACCAAGAGATGATGTTGTTTATAG pLX_317 10.6% 93.5% 93.5% V5 1646_1647ins39;1708_1875del n/a
Download CSV