Transcript: Human XM_011522462.3

PREDICTED: Homo sapiens chromosome 16 open reading frame 72 (C16orf72), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C16orf72 (29035)
Length:
6062
CDS:
669..1385

Additional Resources:

NCBI RefSeq record:
XM_011522462.3
NBCI Gene record:
C16orf72 (29035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267848 GGCTATCAGCGACGCAATAAG pLKO_005 1023 CDS 100% 13.200 18.480 N 1810013L24Rik n/a
2 TRCN0000365289 GGCTATCAGCGACGCAATAAG pLKO_005 1023 CDS 100% 13.200 18.480 N C16orf72 n/a
3 TRCN0000370373 CCGTCACCAATCTCTACAAAG pLKO_005 955 CDS 100% 10.800 15.120 N C16orf72 n/a
4 TRCN0000370372 CTCATCTGTAGAGACTGATTT pLKO_005 1199 CDS 100% 13.200 9.240 N C16orf72 n/a
5 TRCN0000168418 GCTCATCTGTAGAGACTGATT pLKO.1 1198 CDS 100% 4.950 3.465 N C16orf72 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3656 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3657 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03065 pDONR223 100% 79% 70.2% None (many diffs) n/a
2 ccsbBroad304_03065 pLX_304 0% 79% 70.2% V5 (many diffs) n/a
3 TRCN0000466251 ACCCCGAATGCTCAGGTGATCTTA pLX_317 41.8% 79% 70.2% V5 (many diffs) n/a
Download CSV