Transcript: Human XM_011522790.3

PREDICTED: Homo sapiens group 10 secretory phospholipase A2-like (LOC100652777), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC100652777 (100652777)
Length:
1033
CDS:
434..817

Additional Resources:

NCBI RefSeq record:
XM_011522790.3
NBCI Gene record:
LOC100652777 (100652777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050892 CCCATCGCCTATATGAAATAT pLKO.1 608 CDS 100% 15.000 7.500 Y PLA2G10 n/a
2 TRCN0000373209 ATCATGCTGCTCCTGCTACTG pLKO_005 461 CDS 100% 4.050 2.025 Y PLA2G10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01919 pDONR223 100% 75.8% 72.8% None (many diffs) n/a
2 TRCN0000478045 ATCGCGTCCCTCCGAATACGGGGA pLX_317 29.7% 75.8% 72.8% V5 (many diffs) n/a
Download CSV