Transcript: Human XM_011522807.2

PREDICTED: Homo sapiens cadherin 16 (CDH16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH16 (1014)
Length:
2666
CDS:
96..2396

Additional Resources:

NCBI RefSeq record:
XM_011522807.2
NBCI Gene record:
CDH16 (1014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437874 ATTCCCATGGCGAGGACTATG pLKO_005 1024 CDS 100% 10.800 15.120 N CDH16 n/a
2 TRCN0000435688 TCGCAGTCACAGATATCAATG pLKO_005 1405 CDS 100% 10.800 15.120 N CDH16 n/a
3 TRCN0000055617 CCCTTTATACCTGACCAAGTT pLKO.1 206 CDS 100% 4.950 3.960 N CDH16 n/a
4 TRCN0000417931 CCAATTCCCACGTTGTGTATC pLKO_005 1201 CDS 100% 10.800 7.560 N CDH16 n/a
5 TRCN0000055615 CCTGGTGATCCACTTCCTAAA pLKO.1 1859 CDS 100% 10.800 7.560 N CDH16 n/a
6 TRCN0000055614 CCTGGTAGCAATAGGAATCTT pLKO.1 2285 CDS 100% 5.625 3.938 N CDH16 n/a
7 TRCN0000055613 GCAGAGAATCTCAAAGTCCTA pLKO.1 834 CDS 100% 2.640 1.848 N CDH16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00275 pDONR223 100% 92.4% 92.4% None 1357_1358ins189 n/a
2 ccsbBroad304_00275 pLX_304 0% 92.4% 92.4% V5 1357_1358ins189 n/a
3 TRCN0000468786 GCCAACTAATATAGAGAACTTCTC pLX_317 4% 92.4% 92.4% V5 1357_1358ins189 n/a
Download CSV