Transcript: Human XM_011523182.1

PREDICTED: Homo sapiens BTG3 associated nuclear protein (BANP), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BANP (54971)
Length:
1506
CDS:
151..1491

Additional Resources:

NCBI RefSeq record:
XM_011523182.1
NBCI Gene record:
BANP (54971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180678 GCAGAACACCATTGTGGTGAA pLKO.1 666 CDS 100% 4.050 2.835 N BANP n/a
2 TRCN0000245379 GAAACGCCAGCGACTAGAAAT pLKO_005 285 CDS 100% 13.200 7.920 N BANP n/a
3 TRCN0000240888 TTGCCAGGATCCATCTATAAA pLKO_005 309 CDS 100% 15.000 7.500 Y BANP n/a
4 TRCN0000240887 GCCCTGGAGGCTACTTGTAAA pLKO_005 397 CDS 100% 13.200 6.600 Y BANP n/a
5 TRCN0000240885 GGATAGCATTGAAGCCAAATT pLKO_005 372 CDS 100% 13.200 6.600 Y BANP n/a
6 TRCN0000179495 GAAGACGAACCTGCTTTGAAA pLKO.1 268 CDS 100% 5.625 2.813 Y BANP n/a
7 TRCN0000180099 CAATCTGCTTGCGGTTGGATA pLKO.1 356 CDS 100% 4.950 2.475 Y BANP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08437 pDONR223 100% 77.5% 77.4% None (many diffs) n/a
2 ccsbBroad304_08437 pLX_304 0% 77.5% 77.4% V5 (many diffs) n/a
3 TRCN0000479214 AAACTCTGCCCGCTTAAGGGGGTG pLX_317 21.9% 77.5% 77.4% V5 (many diffs) n/a
Download CSV