Transcript: Human XM_011523327.3

PREDICTED: Homo sapiens transport and golgi organization 6 homolog (TANGO6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TANGO6 (79613)
Length:
3149
CDS:
10..2838

Additional Resources:

NCBI RefSeq record:
XM_011523327.3
NBCI Gene record:
TANGO6 (79613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254333 CATGCGGTCTGGATCGGATTT pLKO_005 50 CDS 100% 10.800 15.120 N TANGO6 n/a
2 TRCN0000254335 GATCCGCCTTGCAGCTAATTT pLKO_005 336 CDS 100% 15.000 12.000 N TANGO6 n/a
3 TRCN0000265505 AGAATGTCTGAGCAGATATTC pLKO_005 1966 CDS 100% 13.200 9.240 N TANGO6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14263 pDONR223 100% 41.8% 39.3% None (many diffs) n/a
2 ccsbBroad304_14263 pLX_304 0% 41.8% 39.3% V5 (many diffs) n/a
3 TRCN0000475062 CCACATTCCCAGTGGACGGGTCTG pLX_317 16.6% 41.8% 39.3% V5 (many diffs) n/a
Download CSV