Transcript: Human XM_011523649.2

PREDICTED: Homo sapiens cytochrome b5 domain containing 2 (CYB5D2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYB5D2 (124936)
Length:
1386
CDS:
313..771

Additional Resources:

NCBI RefSeq record:
XM_011523649.2
NBCI Gene record:
CYB5D2 (124936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154267 CCAATACAGTACGAGGCAATA pLKO.1 1119 3UTR 100% 10.800 15.120 N CYB5D2 n/a
2 TRCN0000156943 GACAACCCTCCACACAGAAAT pLKO.1 670 CDS 100% 13.200 9.240 N CYB5D2 n/a
3 TRCN0000152178 CACTTCACAATTGGCTTTCAT pLKO.1 320 CDS 100% 5.625 3.938 N CYB5D2 n/a
4 TRCN0000156327 CTTGGAGGCCAACAAACTACA pLKO.1 450 CDS 100% 4.950 3.465 N CYB5D2 n/a
5 TRCN0000156874 GCTGTATAAGCCAGGTGCTAA pLKO.1 594 CDS 100% 4.950 3.465 N CYB5D2 n/a
6 TRCN0000156687 GCCAATACAGTACGAGGCAAT pLKO.1 1118 3UTR 100% 4.050 2.835 N CYB5D2 n/a
7 TRCN0000153552 CTGACACTTCACAATTGGCTT pLKO.1 316 CDS 100% 2.640 1.848 N CYB5D2 n/a
8 TRCN0000156810 GCCAACAAACTACAGCTGCAA pLKO.1 457 CDS 100% 2.640 1.848 N CYB5D2 n/a
9 TRCN0000153364 GAGATGCTGACACTTCACAAT pLKO.1 310 5UTR 100% 4.950 2.970 N CYB5D2 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 148 5UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 149 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04793 pDONR223 100% 57.5% 57.5% None 0_1ins336 n/a
2 ccsbBroad304_04793 pLX_304 0% 57.5% 57.5% V5 0_1ins336 n/a
3 TRCN0000465792 GTGGAGCCAGTCCTACCCGTGGCC pLX_317 48.2% 57.5% 57.5% V5 0_1ins336 n/a
Download CSV