Transcript: Human XM_011523976.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 4 (MAP2K4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K4 (6416)
Length:
1313
CDS:
54..1013

Additional Resources:

NCBI RefSeq record:
XM_011523976.2
NBCI Gene record:
MAP2K4 (6416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197261 GCATCACGACAAGGATATGAT pLKO.1 921 CDS 100% 5.625 3.938 N MAP2K4 n/a
2 TRCN0000001390 CTTCTTATGGATTTGGATGTA pLKO.1 519 CDS 100% 4.950 3.465 N MAP2K4 n/a
3 TRCN0000197078 GATGTAGTAATGCGGAGTAGT pLKO.1 534 CDS 100% 4.950 3.465 N MAP2K4 n/a
4 TRCN0000001393 GATATGATGTCCGCTCTGATG pLKO.1 934 CDS 100% 4.050 2.835 N MAP2K4 n/a
5 TRCN0000001392 ACGAGGAGCTTATGGTTCTGT pLKO.1 413 CDS 100% 3.000 2.100 N MAP2K4 n/a
6 TRCN0000196996 GACAGCTTGTGGACTCTATTG pLKO.1 841 CDS 100% 10.800 6.480 N MAP2K4 n/a
7 TRCN0000039916 CCCAATCCTACAGGAGTTCAA pLKO.1 273 CDS 100% 4.950 2.475 Y MAP2K4 n/a
8 TRCN0000197204 GTAAACGCAAAGCACTGAAGT pLKO.1 202 CDS 100% 4.950 2.475 Y MAP2K4 n/a
9 TRCN0000039915 GTGGGCAAATAATGGCAGTTA pLKO.1 457 CDS 100% 4.950 2.475 Y MAP2K4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489440 AAACTTTGGGGGACTTTCACTCAG pLX_317 26.9% 74.2% 72% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV