Transcript: Human XM_011524015.3

PREDICTED: Homo sapiens PITPNM family member 3 (PITPNM3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PITPNM3 (83394)
Length:
2980
CDS:
91..2595

Additional Resources:

NCBI RefSeq record:
XM_011524015.3
NBCI Gene record:
PITPNM3 (83394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029769 CTGAGGAATGTCACGGCTAAT pLKO.1 1975 CDS 100% 10.800 7.560 N PITPNM3 n/a
2 TRCN0000029770 CTTGGGCTACATGATCCTTTA pLKO.1 2409 CDS 100% 10.800 7.560 N PITPNM3 n/a
3 TRCN0000029771 GAGATGGCTGAAGGGAAGAAT pLKO.1 211 CDS 100% 5.625 3.938 N PITPNM3 n/a
4 TRCN0000029772 CTTCGATGTGTCCGACTTCTT pLKO.1 1263 CDS 100% 4.950 3.465 N PITPNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09092 pDONR223 100% 85.2% 85.1% None (many diffs) n/a
2 ccsbBroad304_09092 pLX_304 0% 85.2% 85.1% V5 (many diffs) n/a
3 TRCN0000474993 CGCCGCCATTTATAAATCCCCTAA pLX_317 10.1% 85.2% 85.1% V5 (many diffs) n/a
Download CSV