Transcript: Human XM_011524028.2

PREDICTED: Homo sapiens olfactory receptor family 3 subfamily A member 3 (OR3A3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR3A3 (8392)
Length:
1248
CDS:
29..976

Additional Resources:

NCBI RefSeq record:
XM_011524028.2
NBCI Gene record:
OR3A3 (8392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357846 GGTAGCTGCTGTGCTGCAAAT pLKO_005 700 CDS 100% 10.800 8.640 N OR3A3 n/a
2 TRCN0000009399 CTTCTATGGGACAGGTGTCTT pLKO.1 787 CDS 100% 4.950 3.465 N OR3A3 n/a
3 TRCN0000357918 GACAGGTGTCTTCAGCTACAT pLKO_005 796 CDS 100% 4.950 3.465 N OR3A3 n/a
4 TRCN0000009397 GTCTTCATCAGTGTGTCCTAT pLKO.1 671 CDS 100% 4.950 3.465 N OR3A3 n/a
5 TRCN0000357845 GGCACCCTTGGTCTTCATCAG pLKO_005 661 CDS 100% 1.350 0.945 N OR3A3 n/a
6 TRCN0000011790 CTGGGTTCAGTGGAATCTTCA pLKO.1 821 CDS 100% 4.950 2.970 N OR3A3 n/a
7 TRCN0000367805 GCATCTTCTATGGGACAGGTG pLKO_005 783 CDS 100% 2.160 1.296 N OR3A3 n/a
8 TRCN0000009400 GCTGTTGCTGAGTTCATTCTA pLKO.1 59 CDS 100% 5.625 2.813 Y OR3A3 n/a
9 TRCN0000009398 CCTAGTGCAAACAGAAGAGAT pLKO.1 85 CDS 100% 4.950 2.475 Y OR3A3 n/a
10 TRCN0000188431 CTCAATGAGCTGCTGCTCTTT pLKO.1 617 CDS 100% 4.950 2.475 Y Olfr411 n/a
11 TRCN0000009392 CCACAAGTCCACAATTTCCTA pLKO.1 298 CDS 100% 3.000 1.500 Y OR3A2 n/a
12 TRCN0000009395 GCCGTCTTGGTGGAGCCCAAA pLKO.1 179 CDS 100% 0.000 0.000 Y OR3A2 n/a
13 TRCN0000009391 GCCAGTTGTCTTTGTGCTCTT pLKO.1 109 CDS 100% 4.050 2.025 Y OR3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01124 pDONR223 100% 81.5% 77.4% None (many diffs) n/a
2 ccsbBroad304_01124 pLX_304 0% 81.5% 77.4% V5 (many diffs) n/a
3 TRCN0000473068 CCAGCTACATCAAGATTACCTAGT pLX_317 42.9% 81.5% 77.4% V5 (many diffs) n/a
Download CSV