Transcript: Human XM_011524203.3

PREDICTED: Homo sapiens chaperonin containing TCP1 subunit 6B (CCT6B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCT6B (10693)
Length:
1456
CDS:
161..1327

Additional Resources:

NCBI RefSeq record:
XM_011524203.3
NBCI Gene record:
CCT6B (10693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330062 ACAACTTGTGGGCGTAGATTT pLKO_005 1156 CDS 100% 13.200 18.480 N CCT6B n/a
2 TRCN0000142351 GCACCCTAGAATAATAGCTGA pLKO.1 76 5UTR 100% 2.640 3.696 N CCT6B n/a
3 TRCN0000143706 GCAGGAGTTTGGGATAATTAT pLKO.1 1208 CDS 100% 15.000 10.500 N CCT6B n/a
4 TRCN0000353642 GCAGGAGTTTGGGATAATTAT pLKO_005 1208 CDS 100% 15.000 10.500 N CCT6B n/a
5 TRCN0000143520 GCTGATGCCTTACTCATTATT pLKO.1 1055 CDS 100% 15.000 10.500 N CCT6B n/a
6 TRCN0000353589 CCCACAGGAAACATTAGTAAA pLKO_005 1108 CDS 100% 13.200 9.240 N CCT6B n/a
7 TRCN0000330061 CTGGTCTTGTGTATGAGTATA pLKO_005 774 CDS 100% 13.200 9.240 N CCT6B n/a
8 TRCN0000142279 GCTCTGTTACCTTGTTGGTTA pLKO.1 843 CDS 100% 4.950 3.465 N CCT6B n/a
9 TRCN0000330133 GCTCTGTTACCTTGTTGGTTA pLKO_005 843 CDS 100% 4.950 3.465 N CCT6B n/a
10 TRCN0000142669 CCAGATATGAAGAAGCGAGTA pLKO.1 389 CDS 100% 4.050 2.835 N CCT6B n/a
11 TRCN0000141135 CTTCACTCTTGCACAGTGATT pLKO.1 1247 CDS 100% 0.495 0.347 N CCT6B n/a
12 TRCN0000139219 CACAGTGATTGCCACCAACAT pLKO.1 1258 CDS 100% 4.950 2.970 N CCT6B n/a
13 TRCN0000120463 CCAAATAAGCATACTCTCATA pLKO.1 869 CDS 100% 4.950 3.465 N Cct6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14052 pDONR223 100% 73.2% 3.3% None 0_1ins425 n/a
2 ccsbBroad304_14052 pLX_304 0% 73.2% 3.3% V5 (not translated due to prior stop codon) 0_1ins425 n/a
3 TRCN0000468772 GGAAGCTCCTTCTCCACGAGATCA pLX_317 29.6% 73.2% 3.3% V5 (not translated due to prior stop codon) 0_1ins425 n/a
Download CSV