Transcript: Human XM_011524314.2

PREDICTED: Homo sapiens beta-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B4GALNT2 (124872)
Length:
1264
CDS:
213..1175

Additional Resources:

NCBI RefSeq record:
XM_011524314.2
NBCI Gene record:
B4GALNT2 (124872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035641 CGGAAGCTGTTGAAGTTCATT pLKO.1 996 CDS 100% 5.625 4.500 N B4GALNT2 n/a
2 TRCN0000035640 CCTCAAGATATTGGTCATAAT pLKO.1 425 CDS 100% 13.200 9.240 N B4GALNT2 n/a
3 TRCN0000035643 CAGGCTGAATTTGAACACTTT pLKO.1 717 CDS 100% 4.950 3.465 N B4GALNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16083 pDONR223 0% 56.1% 55.8% None (many diffs) n/a
2 ccsbBroad304_16083 pLX_304 0% 56.1% 55.8% V5 (many diffs) n/a
3 TRCN0000481312 CTTGTACGGATAAGCTTGGGGCCG pLX_317 26% 56.1% 55.8% V5 (many diffs) n/a
4 ccsbBroadEn_09487 pDONR223 100% 56.1% 55.8% None (many diffs) n/a
5 ccsbBroad304_09487 pLX_304 0% 56.1% 55.8% V5 (many diffs) n/a
6 TRCN0000480085 TCTCTGAATCAGCCCCCAACATTA pLX_317 23.1% 56.1% 55.8% V5 (many diffs) n/a
Download CSV