Transcript: Human XM_011524494.2

PREDICTED: Homo sapiens solute carrier family 39 member 11 (SLC39A11), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC39A11 (201266)
Length:
2812
CDS:
149..1177

Additional Resources:

NCBI RefSeq record:
XM_011524494.2
NBCI Gene record:
SLC39A11 (201266)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434903 TCCTGATTGACTCTGATTATA pLKO_005 1303 3UTR 100% 15.000 21.000 N SLC39A11 n/a
2 TRCN0000038365 CGGCTCTACGTTGATGAAGAA pLKO.1 496 CDS 100% 4.950 6.930 N SLC39A11 n/a
3 TRCN0000038364 GCCATCACTATACACAACGTT pLKO.1 746 CDS 100% 3.000 4.200 N SLC39A11 n/a
4 TRCN0000038368 GCTCTCGTGTTCGTATTCTCT pLKO.1 227 CDS 100% 3.000 4.200 N SLC39A11 n/a
5 TRCN0000423243 CTTTGAGAGTGCCAGGAATTT pLKO_005 826 CDS 100% 13.200 9.240 N SLC39A11 n/a
6 TRCN0000421707 ATGGGACAACAAGCTTCTTTC pLKO_005 1238 3UTR 100% 10.800 7.560 N SLC39A11 n/a
7 TRCN0000038367 GAAGCCCAGATCAGTGGTAAT pLKO.1 1085 CDS 100% 10.800 7.560 N SLC39A11 n/a
8 TRCN0000429192 GTGAACTTTCCATCCGGATAG pLKO_005 558 CDS 100% 6.000 4.200 N SLC39A11 n/a
9 TRCN0000038366 CCTGGGATTTGTAGTGATGAT pLKO.1 1132 CDS 100% 4.950 3.465 N SLC39A11 n/a
10 TRCN0000421230 CATTGGAATCGGGATCCAGAA pLKO_005 850 CDS 100% 4.050 2.835 N SLC39A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09814 pDONR223 100% 97.8% 97.6% None 331A>G;429_449del n/a
2 ccsbBroad304_09814 pLX_304 0% 97.8% 97.6% V5 331A>G;429_449del n/a
3 TRCN0000480061 CTTTACTTATTCTCTTCTATATTC pLX_317 31.7% 97.8% 97.6% V5 331A>G;429_449del n/a
Download CSV