Transcript: Human XM_011524537.1

PREDICTED: Homo sapiens arylsulfatase G (ARSG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARSG (22901)
Length:
2625
CDS:
573..2231

Additional Resources:

NCBI RefSeq record:
XM_011524537.1
NBCI Gene record:
ARSG (22901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148698 AGGTAAGGGCACGTGCATGT pXPR_003 GGG 748 45% 7 1.2205 ARSG ARSG 77642
2 BRDN0001147989 TCCAGCCAAGCAGACGACCT pXPR_003 GGG 1006 61% 9 0.3672 ARSG ARSG 77640
3 BRDN0001147874 CACAGGGTGATGGACCATCA pXPR_003 AGG 561 34% 5 0.2385 ARSG ARSG 77641
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358764 GTTACGTCACTGGGATAATAG pLKO_005 958 CDS 100% 13.200 18.480 N ARSG n/a
2 TRCN0000051347 CACGCAACTTTGCAGTCACTT pLKO.1 880 CDS 100% 4.950 6.930 N ARSG n/a
3 TRCN0000358697 CAACATCTCCAGCGCAGATTA pLKO_005 2141 CDS 100% 13.200 9.240 N ARSG n/a
4 TRCN0000358699 CTACTTTGGAATCCCATATAG pLKO_005 1037 CDS 100% 13.200 9.240 N ARSG n/a
5 TRCN0000358698 ATGGAGTCACACGCAACTTTG pLKO_005 871 CDS 100% 10.800 7.560 N ARSG n/a
6 TRCN0000051346 CCTCTGGTTTACAGGAGACAA pLKO.1 1460 CDS 100% 4.950 3.465 N ARSG n/a
7 TRCN0000051343 CCTGCTGTAATCCCTACCAAA pLKO.1 2185 CDS 100% 4.950 3.465 N ARSG n/a
8 TRCN0000051344 GCAGCATAAGTTTCCTCTGAT pLKO.1 1997 CDS 100% 4.950 3.465 N ARSG n/a
9 TRCN0000051345 CCAACCTTGATAAGATGGCTT pLKO.1 757 CDS 100% 2.640 1.848 N ARSG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02699 pDONR223 100% 95.1% 95.1% None 1212_1292del n/a
2 ccsbBroad304_02699 pLX_304 0% 95.1% 95.1% V5 1212_1292del n/a
3 TRCN0000469774 ACAAAAGAGATATGAGTGGAACCG pLX_317 25.2% 95.1% 95.1% V5 1212_1292del n/a
4 ccsbBroadEn_14999 pDONR223 0% 95.1% 95.1% None 1212_1292del n/a
5 ccsbBroad304_14999 pLX_304 0% 95.1% 95.1% V5 1212_1292del n/a
6 TRCN0000466305 CGATAGACTCGCTCTCTATTGGCC pLX_317 18.6% 95.1% 95.1% V5 1212_1292del n/a
Download CSV