Transcript: Human XM_011525074.2

PREDICTED: Homo sapiens Rho GTPase activating protein 23 (ARHGAP23), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP23 (57636)
Length:
5962
CDS:
352..4545

Additional Resources:

NCBI RefSeq record:
XM_011525074.2
NBCI Gene record:
ARHGAP23 (57636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424479 GAAAGGGAACGAGCCGTATTC pLKO_005 576 CDS 100% 10.800 15.120 N ARHGAP23 n/a
2 TRCN0000430926 GATGCGACCTTCAGCGATATC pLKO_005 2116 CDS 100% 10.800 15.120 N ARHGAP23 n/a
3 TRCN0000048472 CGCCACTTCATCGTGTACCCA pLKO.1 244 5UTR 100% 0.250 0.200 N ARHGAP23 n/a
4 TRCN0000048471 AGACAGATGAACCTTGGATTT pLKO.1 1588 CDS 100% 10.800 7.560 N ARHGAP23 n/a
5 TRCN0000339830 AGTACCTCCTGCCCAACATTG pLKO_005 3431 CDS 100% 10.800 7.560 N Arhgap23 n/a
6 TRCN0000048470 GCTCTGATCCAGAATAGTGAT pLKO.1 481 CDS 100% 4.950 3.465 N ARHGAP23 n/a
7 TRCN0000184726 CAACTTCAACGAGTGGAAGGA pLKO.1 4320 CDS 100% 2.640 1.848 N Arhgap23 n/a
8 TRCN0000048468 CCTCAACTTCAACGAGTGGAA pLKO.1 4317 CDS 100% 2.640 1.848 N ARHGAP23 n/a
9 TRCN0000195757 CCTCAACTTCAACGAGTGGAA pLKO.1 4317 CDS 100% 2.640 1.848 N Arhgap23 n/a
10 TRCN0000048469 CCGGAGCTACAGCCCATCATT pLKO.1 1326 CDS 100% 1.875 1.313 N ARHGAP23 n/a
11 TRCN0000339829 CTGATCAGCAAGAAGCTTAAT pLKO_005 2530 CDS 100% 13.200 7.920 N Arhgap23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.