Transcript: Human XM_011525096.1

PREDICTED: Homo sapiens retinoic acid receptor alpha (RARA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RARA (5914)
Length:
2647
CDS:
16..1230

Additional Resources:

NCBI RefSeq record:
XM_011525096.1
NBCI Gene record:
RARA (5914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020372 ACTACGAACAACAGCTCAGAA pLKO.1 466 CDS 100% 4.950 3.960 N RARA n/a
2 TRCN0000020369 CGCATCTACAAGCCTTGCTTT pLKO.1 88 CDS 100% 4.950 3.960 N RARA n/a
3 TRCN0000285401 GGTATTAATTCTCGCTGGTTT pLKO_005 1720 3UTR 100% 4.950 3.960 N RARA n/a
4 TRCN0000275491 TCATTGAGAAGGTGCGCAAAG pLKO_005 401 CDS 100% 6.000 4.200 N RARA n/a
5 TRCN0000020370 CCCAAGATGCTAATGAAGATT pLKO.1 964 CDS 100% 5.625 3.938 N RARA n/a
6 TRCN0000275552 CCCAAGATGCTAATGAAGATT pLKO_005 964 CDS 100% 5.625 3.938 N RARA n/a
7 TRCN0000275553 CATTGACCTCTGGGACAAGTT pLKO_005 504 CDS 100% 4.950 3.465 N RARA n/a
8 TRCN0000020371 GTCTGTGAGAAACGACCGAAA pLKO.1 309 CDS 100% 4.050 2.835 N RARA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15561 pDONR223 0% 88.3% 87.9% None 0_1ins148;4_4delCinsGCTCAAACCACT n/a
2 ccsbBroad304_15561 pLX_304 0% 88.3% 87.9% V5 0_1ins148;4_4delCinsGCTCAAACCACT n/a
3 ccsbBroadEn_01375 pDONR223 100% 87.3% 87% None 0_1ins167;3G>C;4_5insCCAGCCA n/a
4 ccsbBroad304_01375 pLX_304 0% 87.3% 87% V5 0_1ins167;3G>C;4_5insCCAGCCA n/a
5 TRCN0000492202 TTTGGTGCCCCTTCGCAGCCGACC pLX_317 8.1% 87.3% 87% V5 0_1ins167;3G>C;4_5insCCAGCCA n/a
6 TRCN0000488701 CTCTTGACCGTCCGGCAAGACCCG pLX_317 25.8% 87.3% 87% V5 (not translated due to prior stop codon) 0_1ins167;3G>C;4_5insCCAGCCA n/a
7 TRCN0000489444 CCTTCAACCGGCCTCAACCATGCC pLX_317 26.2% 87.3% 86.8% V5 (many diffs) n/a
Download CSV