Construct: ORF TRCN0000488701
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021639.1_s317c1
- DNA Barcode:
- CTCTTGACCGTCCGGCAAGACCCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- RARA (5914)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488701
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5914 | RARA | retinoic acid receptor alpha | NM_000964.4 | 100% | 100% | |
| 2 | human | 5914 | RARA | retinoic acid receptor alpha | NM_001145301.3 | 100% | 100% | |
| 3 | human | 5914 | RARA | retinoic acid receptor alpha | XM_005257553.1 | 100% | 100% | |
| 4 | human | 5914 | RARA | retinoic acid receptor alpha | XM_005257554.1 | 100% | 100% | |
| 5 | human | 5914 | RARA | retinoic acid receptor alpha | XM_011525095.1 | 100% | 100% | |
| 6 | human | 5914 | RARA | retinoic acid receptor alpha | NM_001024809.4 | 91% | 86% | (many diffs) |
| 7 | human | 5914 | RARA | retinoic acid receptor alpha | XM_005257552.5 | 90.3% | 86.3% | (many diffs) |
| 8 | human | 5914 | RARA | retinoic acid receptor alpha | XM_011525096.1 | 87.3% | 87% | 0_1ins167;3G>C;4_5insCCAGCCA |
| 9 | human | 5914 | RARA | retinoic acid receptor alpha | NM_001145302.3 | 79% | 79% | 178_179ins291 |
| 10 | human | 5914 | RARA | retinoic acid receptor alpha | XM_017024920.2 | 74.2% | 74.2% | 0_1ins357 |
| 11 | mouse | 19401 | Rara | retinoic acid receptor, alpha | NM_001177302.1 | 91.5% | 98.2% | (many diffs) |
| 12 | mouse | 19401 | Rara | retinoic acid receptor, alpha | NM_001177303.1 | 91.5% | 98.2% | (many diffs) |
| 13 | mouse | 19401 | Rara | retinoic acid receptor, alpha | NM_009024.2 | 91.5% | 98.2% | (many diffs) |
| 14 | mouse | 19401 | Rara | retinoic acid receptor, alpha | XM_006532592.3 | 91.5% | 98.2% | (many diffs) |
| 15 | mouse | 19401 | Rara | retinoic acid receptor, alpha | XM_006532593.2 | 91.5% | 98.2% | (many diffs) |
| 16 | mouse | 19401 | Rara | retinoic acid receptor, alpha | XM_017314353.1 | 91.5% | 98.2% | (many diffs) |
| 17 | mouse | 19401 | Rara | retinoic acid receptor, alpha | NM_001176528.1 | 83.7% | 84.5% | (many diffs) |
| 18 | mouse | 19401 | Rara | retinoic acid receptor, alpha | XM_006532596.2 | 68% | 72.7% | (many diffs) |
| 19 | mouse | 19401 | Rara | retinoic acid receptor, alpha | XM_006532597.2 | 68% | 72.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1458
- ORF length:
- 1386
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccagc aacagcagct cctgcccgac acctgggggc gggcacctca 121 atgggtaccc ggtgcctccc tacgccttct tcttcccccc tatgctgggt ggactctccc 181 cgccaggcgc tctgaccact ctccagcacc agcttccagt tagtggatat agcacaccat 241 ccccagccac cattgagacc cagagcagca gttctgaaga gatagtgccc agccctccct 301 cgccaccccc tctaccccgc atctacaagc cttgctttgt ctgtcaggac aagtcctcag 361 gctaccacta tggggtcagc gcctgtgagg gctgcaaggg cttcttccgc cgcagcatcc 421 agaagaacat ggtgtacacg tgtcaccggg acaagaactg catcatcaac aaggtgaccc 481 ggaaccgctg ccagtactgc cgactgcaga agtgctttga agtgggcatg tccaaggagt 541 ctgtgagaaa cgaccgaaac aagaagaaga aggaggtgcc caagcccgag tgctctgaga 601 gctacacgct gacgccggag gtgggggagc tcattgagaa ggtgcgcaaa gcgcaccagg 661 aaaccttccc tgccctctgc cagctgggca aatacactac gaacaacagc tcagaacaac 721 gtgtctctct ggacattgac ctctgggaca agttcagtga actctccacc aagtgcatca 781 ttaagactgt ggagttcgcc aagcagctgc ccggcttcac caccctcacc atcgccgacc 841 agatcaccct cctcaaggct gcctgcctgg acatcctgat cctgcggatc tgcacgcggt 901 acacgcccga gcaggacacc atgaccttct cggacgggct gaccctgaac cggacccaga 961 tgcacaacgc tggcttcggc cccctcaccg acctggtctt tgccttcgcc aaccagctgc 1021 tgcccctgga gatggatgat gcggagacgg ggctgctcag cgccatctgc ctcatctgcg 1081 gagaccgcca ggacctggag cagccGGACC GGGTGGACAT GCTGCAGGAG CCGCTGCTGG 1141 AGGCGCTAAA GGTCTACGTG CGGAAGCGGA GGCCCAGCCG CCCCCACATG TTCCCCAAGA 1201 TGCTAATGAA GATTACTGAC CTGCGAAGCA TCAGCGCCAA GGGGGCTGAG CGGGTGATCA 1261 CGCTGAAGAT GGAGATCCCG GGCTCCATGC CGCCTCTCAT CCAGGAAATG TTGGAGAACT 1321 CAGAGGGCCT GGACACTCTG AGCGGACAGC CGGGGGGTGG GGGGCGGGAC GGGGGTGGCC 1381 TGGCCCCCCC GCCAGGCAGC TGTAGCCCCA GCCTCAGCCC CAGCTCCAAC AGAAGCAGCC 1441 CGGCCACCCA CTCCCCGTGA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1501 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1561 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTCT TGACCGTCCG 1621 GCAAGACCCG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt