Transcript: Human XM_011525340.3

PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRIP1 (83990)
Length:
3521
CDS:
864..3425

Additional Resources:

NCBI RefSeq record:
XM_011525340.3
NBCI Gene record:
BRIP1 (83990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358768 ACTAAAGGCCTGTCCATATTA pLKO_005 1901 CDS 100% 15.000 12.000 N BRIP1 n/a
2 TRCN0000049914 CGTCAGAACTTGGTGTTACAT pLKO.1 2734 CDS 100% 5.625 4.500 N BRIP1 n/a
3 TRCN0000049916 CCAAGGAACTTCACGTCATTT pLKO.1 1166 CDS 100% 13.200 9.240 N BRIP1 n/a
4 TRCN0000049913 GCTAAGAAACAGGCATCCATA pLKO.1 1281 CDS 100% 4.950 3.465 N BRIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09143 pDONR223 100% 65.6% 65.4% None (many diffs) n/a
2 ccsbBroad304_09143 pLX_304 0% 65.6% 65.4% V5 (many diffs) n/a
3 TRCN0000477014 AAGGTTTATCCCAAGTATCTGTGT pLX_317 12.2% 65.6% 65.4% V5 (many diffs) n/a
Download CSV