Transcript: Human XM_011525797.1

PREDICTED: Homo sapiens DNA polymerase iota (POLI), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLI (11201)
Length:
1568
CDS:
50..1342

Additional Resources:

NCBI RefSeq record:
XM_011525797.1
NBCI Gene record:
POLI (11201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415528 TCGGGTCATGTATACAATAAT pLKO_005 584 CDS 100% 15.000 21.000 N POLI n/a
2 TRCN0000437553 AGAGTCGTCAGTGCCCTATTC pLKO_005 1197 CDS 100% 10.800 15.120 N POLI n/a
3 TRCN0000053044 CCCGCTACAGAGAAATGTCTT pLKO.1 423 CDS 100% 4.950 6.930 N POLI n/a
4 TRCN0000435443 AGTGTCCACAGTTGGTATTAG pLKO_005 384 CDS 100% 13.200 9.240 N POLI n/a
5 TRCN0000435359 TGAAAGTTGTCAACATCTTAT pLKO_005 793 CDS 100% 13.200 9.240 N POLI n/a
6 TRCN0000425299 TGGTGGTTACCTGCAACTATG pLKO_005 309 CDS 100% 10.800 7.560 N POLI n/a
7 TRCN0000053046 CCTCAGTCCTTTAGTGAAGAA pLKO.1 1019 CDS 100% 4.950 3.465 N POLI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11612 pDONR223 100% 52.7% 50.5% None (many diffs) n/a
2 ccsbBroad304_11612 pLX_304 0% 52.7% 50.5% V5 (many diffs) n/a
3 TRCN0000470567 TACGATTCACGACTCTGAGCCCAA pLX_317 20.7% 52.7% 50.5% V5 (many diffs) n/a
Download CSV