Transcript: Human XM_011525830.2

PREDICTED: Homo sapiens ankyrin repeat domain 29 (ANKRD29), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD29 (147463)
Length:
3281
CDS:
175..981

Additional Resources:

NCBI RefSeq record:
XM_011525830.2
NBCI Gene record:
ANKRD29 (147463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285001 ACGATGGCACAACAGCATTAT pLKO_005 701 CDS 100% 13.200 18.480 N ANKRD29 n/a
2 TRCN0000005433 GCTCTATTGTTGGGAATCTAT pLKO.1 1778 3UTR 100% 5.625 7.875 N ANKRD29 n/a
3 TRCN0000273505 TACTTGGATGTTATTCGATTA pLKO_005 544 CDS 100% 10.800 8.640 N ANKRD29 n/a
4 TRCN0000273558 AGCTAACTTAGCTCCATATTT pLKO_005 976 CDS 100% 15.000 10.500 N ANKRD29 n/a
5 TRCN0000273560 TGTATGTCATTCCAGTATAAA pLKO_005 1453 3UTR 100% 15.000 10.500 N ANKRD29 n/a
6 TRCN0000005437 CAAAGGGTATAATGATGTCAT pLKO.1 735 CDS 100% 4.950 3.465 N ANKRD29 n/a
7 TRCN0000005435 TCCCTGAGAAACAAGGCCAAT pLKO.1 883 CDS 100% 4.050 2.835 N ANKRD29 n/a
8 TRCN0000273559 TCCCTGAGAAACAAGGCCAAT pLKO_005 883 CDS 100% 4.050 2.835 N ANKRD29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09647 pDONR223 100% 88.8% 88.7% None 231_232ins99;236G>A;804C>T n/a
2 ccsbBroad304_09647 pLX_304 0% 88.8% 88.7% V5 231_232ins99;236G>A;804C>T n/a
3 TRCN0000470863 CACTCTGCGTTCGAGAACACGTGC pLX_317 49% 88.8% 88.7% V5 231_232ins99;236G>A;804C>T n/a
Download CSV