Transcript: Human XM_011525889.1

PREDICTED: Homo sapiens phosphatidylinositol glycan anchor biosynthesis class N (PIGN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIGN (23556)
Length:
4961
CDS:
417..3329

Additional Resources:

NCBI RefSeq record:
XM_011525889.1
NBCI Gene record:
PIGN (23556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412394 ACTCTAGAGCACCGTTTATTA pLKO_005 616 CDS 100% 15.000 21.000 N PIGN n/a
2 TRCN0000433357 GCAGATGCACTTTACGAATTA pLKO_005 582 CDS 100% 13.200 18.480 N PIGN n/a
3 TRCN0000142421 GCCAGACATCTCTCTAGTGAT pLKO.1 2258 CDS 100% 4.950 6.930 N PIGN n/a
4 TRCN0000144229 CGTGTCTATGTTTAACCACTT pLKO.1 1139 CDS 100% 4.050 5.670 N PIGN n/a
5 TRCN0000142457 GCTGGCTTGATATTGGGACAA pLKO.1 3067 CDS 100% 4.050 5.670 N PIGN n/a
6 TRCN0000433569 GTCTCATTCCAACCTTATAAA pLKO_005 1808 CDS 100% 15.000 10.500 N PIGN n/a
7 TRCN0000420910 ACCAGGTGCCACCGTCAATAT pLKO_005 3742 3UTR 100% 13.200 9.240 N PIGN n/a
8 TRCN0000145328 GCAGAGAGCATGTTTACAAAT pLKO.1 1485 CDS 100% 13.200 9.240 N PIGN n/a
9 TRCN0000141512 CTGGTCATCCTTCAGAGACTT pLKO.1 1234 CDS 100% 4.950 3.465 N PIGN n/a
10 TRCN0000145406 GTCAGAAATCAGTTTGGCAAA pLKO.1 4561 3UTR 100% 4.050 2.835 N PIGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07902 pDONR223 100% 95.9% 95.7% None 685C>G;741C>T;2672_2788del n/a
2 ccsbBroad304_07902 pLX_304 0% 95.9% 95.7% V5 685C>G;741C>T;2672_2788del n/a
3 TRCN0000478909 CATGCCTACAGCTCCCATTTCCCG pLX_317 13% 95.9% 95.7% V5 685C>G;741C>T;2672_2788del n/a
Download CSV