Transcript: Human XM_011526135.3

PREDICTED: Homo sapiens BCL2 apoptosis regulator (BCL2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCL2 (596)
Length:
2554
CDS:
1397..2071

Additional Resources:

NCBI RefSeq record:
XM_011526135.3
NBCI Gene record:
BCL2 (596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526135.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040071 GTGATGAAGTACATCCATTAT pLKO.1 1439 CDS 100% 13.200 9.240 N BCL2 n/a
2 TRCN0000286223 GTGATGAAGTACATCCATTAT pLKO_005 1439 CDS 100% 13.200 9.240 N BCL2 n/a
3 TRCN0000004681 GCACACCTGGATCCAGGATAA pLKO.1 1951 CDS 100% 10.800 7.560 N Bcl2 n/a
4 TRCN0000298549 GCACACCTGGATCCAGGATAA pLKO_005 1951 CDS 100% 10.800 7.560 N BCL2 n/a
5 TRCN0000040069 CCGGGAGATAGTGATGAAGTA pLKO.1 1429 CDS 100% 4.950 3.465 N BCL2 n/a
6 TRCN0000004679 GTGGATGACTGAGTACCTGAA pLKO.1 1921 CDS 100% 4.050 2.835 N Bcl2 n/a
7 TRCN0000010303 TGGATGACTGAGTACCTGAAC pLKO.1 1922 CDS 100% 4.050 2.835 N BCL2 n/a
8 TRCN0000293675 TGGATGACTGAGTACCTGAAC pLKO_005 1922 CDS 100% 4.050 2.835 N BCL2 n/a
9 TRCN0000040072 CGCCCTGTGGATGACTGAGTA pLKO.1 1915 CDS 100% 1.650 1.155 N BCL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526135.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489662 CACTTATCCGGTGATTTCCGTTCC pLX_317 52.7% 85.2% 79.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV