Transcript: Human XM_011526226.3

PREDICTED: Homo sapiens maestro (MRO), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRO (83876)
Length:
3789
CDS:
232..822

Additional Resources:

NCBI RefSeq record:
XM_011526226.3
NBCI Gene record:
MRO (83876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147552 GCAGTTCTTCTACGCAAATAA pLKO.1 792 CDS 100% 15.000 21.000 N MRO n/a
2 TRCN0000147666 GCAGGTACACACTTTCTTTAA pLKO.1 1060 3UTR 100% 13.200 10.560 N MRO n/a
3 TRCN0000414995 GTATTTGCTATTGATACTTTG pLKO_005 1254 3UTR 100% 10.800 7.560 N MRO n/a
4 TRCN0000149115 GAATACAGCTTCCAGAGTGAA pLKO.1 712 CDS 100% 4.950 3.465 N MRO n/a
5 TRCN0000128908 GAAAGCTAACACATAGGGAAA pLKO.1 1603 3UTR 100% 4.050 2.835 N MRO n/a
6 TRCN0000131052 CCACTATCATCCAGAGATCCT pLKO.1 771 CDS 100% 2.640 1.848 N MRO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09125 pDONR223 100% 78.6% 78.2% None (many diffs) n/a
2 ccsbBroad304_09125 pLX_304 0% 78.6% 78.2% V5 (many diffs) n/a
3 TRCN0000467637 TGAGCAAGTGAAACAAACTGTCTT pLX_317 48.5% 78.6% 78.2% V5 (many diffs) n/a
Download CSV