Transcript: Human XM_011526328.2

PREDICTED: Homo sapiens zinc finger protein 274 (ZNF274), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF274 (10782)
Length:
1999
CDS:
564..1580

Additional Resources:

NCBI RefSeq record:
XM_011526328.2
NBCI Gene record:
ZNF274 (10782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229702 ACCTTCAGTCGGAGTACTAAA pLKO_005 1077 CDS 100% 13.200 18.480 N ZNF274 n/a
2 TRCN0000229701 CAAACGTGACTCACAAGTTAA pLKO_005 971 CDS 100% 13.200 18.480 N ZNF274 n/a
3 TRCN0000014855 CGCAAACGTGACTCACAAGTT pLKO.1 969 CDS 100% 4.950 6.930 N ZNF274 n/a
4 TRCN0000014853 CCACAATAGGACAAAGCGAAA pLKO.1 1538 CDS 100% 4.050 5.670 N ZNF274 n/a
5 TRCN0000014856 GCCCATATGCATGCAACAAAT pLKO.1 1468 CDS 100% 0.000 0.000 N ZNF274 n/a
6 TRCN0000219005 TCTTGACACAAACCAAGTTTC pLKO_005 851 CDS 100% 10.800 7.560 N ZNF274 n/a
7 TRCN0000014854 CCAGCCTGAAAGTACAAGAAT pLKO.1 667 CDS 100% 5.625 3.938 N ZNF274 n/a
8 TRCN0000229703 TGTTCACTCATTTAGTCATTA pLKO_005 1814 3UTR 100% 13.200 7.920 N ZNF274 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07679 pDONR223 100% 51.7% 51.7% None 0_1ins945 n/a
2 ccsbBroad304_07679 pLX_304 0% 51.7% 51.7% V5 0_1ins945 n/a
3 TRCN0000474016 CCGCTAGCAGTTTAACTAGCCATC pLX_317 20.4% 51.7% 51.7% V5 0_1ins945 n/a
Download CSV