Transcript: Human XM_011526396.2

PREDICTED: Homo sapiens CLK4 associating serine/arginine rich protein (CLASRP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLASRP (11129)
Length:
2307
CDS:
94..2196

Additional Resources:

NCBI RefSeq record:
XM_011526396.2
NBCI Gene record:
CLASRP (11129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075090 CCCGATACAGTCGAGAATACA pLKO.1 2120 CDS 100% 5.625 7.875 N CLASRP n/a
2 TRCN0000075091 GCGGAGAGAGTTTCGGGAGAA pLKO.1 903 CDS 100% 1.350 1.890 N CLASRP n/a
3 TRCN0000298170 GCGGAGAGAGTTTCGGGAGAA pLKO_005 903 CDS 100% 1.350 1.890 N CLASRP n/a
4 TRCN0000298545 GAGCGGAGACGGGAGTATTAT pLKO_005 163 CDS 100% 15.000 10.500 N CLASRP n/a
5 TRCN0000293730 AGAAGGCTTCCATCGGTTATA pLKO_005 569 CDS 100% 13.200 9.240 N CLASRP n/a
6 TRCN0000075088 CCAGATCTACATTGATGAGTT pLKO.1 495 CDS 100% 4.950 3.465 N CLASRP n/a
7 TRCN0000075089 CAACAACATGATTGACCGATT pLKO.1 312 CDS 100% 4.050 2.835 N CLASRP n/a
8 TRCN0000286220 CAACAACATGATTGACCGATT pLKO_005 312 CDS 100% 4.050 2.835 N CLASRP n/a
9 TRCN0000075092 CCGCGAGGAGAAGATCACGTT pLKO.1 1056 CDS 100% 0.880 0.616 N CLASRP n/a
10 TRCN0000286219 CCGCGAGGAGAAGATCACGTT pLKO_005 1056 CDS 100% 0.880 0.616 N CLASRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11599 pDONR223 100% 28.7% 20.9% None 1_45del;501_1159del;1308_2100del n/a
2 ccsbBroad304_11599 pLX_304 0% 28.7% 20.9% V5 1_45del;501_1159del;1308_2100del n/a
3 TRCN0000473824 GGGCTTCATTACTAATACTCACGT pLX_317 73% 28.7% 10.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV