Transcript: Human XM_011526437.2

PREDICTED: Homo sapiens IZUMO family member 2 (IZUMO2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IZUMO2 (126123)
Length:
719
CDS:
43..693

Additional Resources:

NCBI RefSeq record:
XM_011526437.2
NBCI Gene record:
IZUMO2 (126123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135404 GTACCAGATGGACAGCAAATA pLKO.1 517 CDS 100% 0.000 0.000 N IZUMO2 n/a
2 TRCN0000137316 GAGGATCACTCCCAAGTGTAT pLKO.1 477 CDS 100% 4.950 3.465 N IZUMO2 n/a
3 TRCN0000135572 GACAAATCAACTGGACCTTGT pLKO.1 276 CDS 100% 4.050 2.835 N IZUMO2 n/a
4 TRCN0000135796 CATCCTCATTTCTGTGTCTCT pLKO.1 562 CDS 100% 2.640 1.848 N IZUMO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13114 pDONR223 100% 63.3% 45.7% None (many diffs) n/a
2 ccsbBroad304_13114 pLX_304 0% 63.3% 45.7% V5 (many diffs) n/a
3 TRCN0000469782 CTCACGCGATGCTTAGCCGCCAGA pLX_317 69.9% 63.3% 45.7% V5 (many diffs) n/a
Download CSV