Transcript: Human XM_011526490.2

PREDICTED: Homo sapiens coiled-coil domain containing 155 (CCDC155), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC155 (147872)
Length:
2383
CDS:
206..1891

Additional Resources:

NCBI RefSeq record:
XM_011526490.2
NBCI Gene record:
CCDC155 (147872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082670 GCTCTTTGAGTGTGAACACCT pLKO.1 1087 CDS 100% 2.640 2.112 N CCDC155 n/a
2 TRCN0000359763 AGCAGTGTCTAGCTCAATAAA pLKO_005 1913 3UTR 100% 15.000 10.500 N CCDC155 n/a
3 TRCN0000359691 ATTAAGCACTAAGGATTATTC pLKO_005 2098 3UTR 100% 13.200 9.240 N CCDC155 n/a
4 TRCN0000368656 GTCAGCTTGGAGGAGCAAATA pLKO_005 293 CDS 100% 13.200 9.240 N CCDC155 n/a
5 TRCN0000359764 TTGAGTGTGAACACCTCATTT pLKO_005 1092 CDS 100% 13.200 9.240 N CCDC155 n/a
6 TRCN0000082671 CATTTGCCAAAGAGACACCAT pLKO.1 1108 CDS 100% 2.640 1.848 N CCDC155 n/a
7 TRCN0000082668 CCAGTAATGGATTAAGCACTA pLKO.1 2088 3UTR 100% 4.050 2.430 N CCDC155 n/a
8 TRCN0000082672 CCCAGGATGCACGCCTCCAAA pLKO.1 411 CDS 100% 0.000 0.000 N CCDC155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09650 pDONR223 100% 99.2% 99.2% None (many diffs) n/a
2 ccsbBroad304_09650 pLX_304 0% 99.2% 99.2% V5 (many diffs) n/a
3 TRCN0000469641 CCCTGACCCTTACCAGGGCAAAAC pLX_317 25.3% 99.2% 99.2% V5 (many diffs) n/a
Download CSV