Transcript: Human XM_011526539.3

PREDICTED: Homo sapiens zinc finger protein 569 (ZNF569), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF569 (148266)
Length:
3652
CDS:
141..2201

Additional Resources:

NCBI RefSeq record:
XM_011526539.3
NBCI Gene record:
ZNF569 (148266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436453 GTATCAACGAAGAACTATAAA pLKO_005 2522 3UTR 100% 15.000 21.000 N ZNF569 n/a
2 TRCN0000419698 GCAGACATCTTATTGATAATA pLKO_005 2400 3UTR 100% 15.000 10.500 N ZNF569 n/a
3 TRCN0000418841 TGATGGAGGAAGAAGTATTAA pLKO_005 343 CDS 100% 15.000 10.500 N ZNF569 n/a
4 TRCN0000016001 CTCATCTCTTACCCTTCATAT pLKO.1 2078 CDS 100% 13.200 9.240 N ZNF569 n/a
5 TRCN0000427571 GTTAGGTCTTTATCAAGTTAT pLKO_005 2612 3UTR 100% 13.200 9.240 N ZNF569 n/a
6 TRCN0000016000 CCCTTCATTTGAGAAGTCATA pLKO.1 1753 CDS 100% 4.950 3.465 N ZNF569 n/a
7 TRCN0000015998 CGAGGACATACAGGTGAGAAA pLKO.1 2016 CDS 100% 4.950 3.465 N ZNF569 n/a
8 TRCN0000015999 GCCTTATGAGAAAGGAGCATT pLKO.1 613 CDS 100% 4.950 3.465 N ZNF569 n/a
9 TRCN0000016002 CCAGACACAATCTCTATGAGT pLKO.1 535 CDS 100% 3.000 2.100 N ZNF569 n/a
10 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 1443 CDS 100% 13.200 6.600 Y Gm11677 n/a
11 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1018 CDS 100% 5.625 2.813 Y ZNF345 n/a
12 TRCN0000148104 GAGTGTAATGAATGTGGGAAA pLKO.1 1455 CDS 100% 4.050 2.025 Y ZNF658B n/a
13 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1607 CDS 100% 13.200 6.600 Y Zfp977 n/a
14 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1366 CDS 100% 5.625 2.813 Y ZNF570 n/a
15 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1365 CDS 100% 4.950 2.475 Y ZNF829 n/a
16 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 2022 CDS 100% 4.050 2.025 Y ZNF260 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15260 pDONR223 59.5% 76.8% 76.8% None 1_477del n/a
2 ccsbBroad304_15260 pLX_304 0% 76.8% 76.8% V5 1_477del n/a
3 TRCN0000473293 AAATTACCAAATTATGGCATAGAT pLX_317 18.2% 44.1% 44% V5 (many diffs) n/a
Download CSV