Transcript: Human XM_011526557.3

PREDICTED: Homo sapiens adaptor related protein complex 2 subunit alpha 1 (AP2A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP2A1 (160)
Length:
4041
CDS:
767..3685

Additional Resources:

NCBI RefSeq record:
XM_011526557.3
NBCI Gene record:
AP2A1 (160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382173 ATGGACGCAGAAGTTACTAAG pLKO_005 3446 CDS 100% 10.800 15.120 N AP2A1 n/a
2 TRCN0000065109 GCACATTGACACCGTCATCAA pLKO.1 1921 CDS 100% 4.950 6.930 N AP2A1 n/a
3 TRCN0000286457 GCACATTGACACCGTCATCAA pLKO_005 1921 CDS 100% 4.950 6.930 N AP2A1 n/a
4 TRCN0000065111 CGCAGAAGTTACTAAGGCCAA pLKO.1 3451 CDS 100% 2.160 3.024 N AP2A1 n/a
5 TRCN0000380035 GCCTTGGATGGCTACAGTAAG pLKO_005 962 CDS 100% 10.800 8.640 N AP2A1 n/a
6 TRCN0000293892 GAGCAAAGAGGCGGAAATTAA pLKO_005 889 CDS 100% 15.000 10.500 N AP2A1 n/a
7 TRCN0000379841 AGCCGATGAGTTGCTGAATAA pLKO_005 2968 CDS 100% 13.200 9.240 N AP2A1 n/a
8 TRCN0000380729 TCGGTGCAGTTCCAGAATTTC pLKO_005 3104 CDS 100% 13.200 9.240 N AP2A1 n/a
9 TRCN0000380923 GCCGCATGTATCTCTTCTATG pLKO_005 3072 CDS 100% 10.800 7.560 N AP2A1 n/a
10 TRCN0000293893 ACCTCCACTGGTGACAGAGAA pLKO_005 3762 3UTR 100% 4.950 3.465 N AP2A1 n/a
11 TRCN0000065110 GCAAATAGGTTACCTGTTCAT pLKO.1 1090 CDS 100% 4.950 3.465 N AP2A1 n/a
12 TRCN0000065108 GCTGAATAAGTTTGTGTGTAA pLKO.1 2980 CDS 100% 4.950 3.465 N AP2A1 n/a
13 TRCN0000382122 GACAGAGAAGACACCAGGGTT pLKO_005 3774 3UTR 100% 2.640 1.848 N AP2A1 n/a
14 TRCN0000065112 CCTCATCAACAACGCCATCAA pLKO.1 1147 CDS 100% 4.950 2.970 N AP2A1 n/a
15 TRCN0000286456 CCTCATCAACAACGCCATCAA pLKO_005 1147 CDS 100% 4.950 2.970 N AP2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14534 pDONR223 58.4% 91.2% 55.8% None (many diffs) n/a
2 ccsbBroad304_14534 pLX_304 0% 91.2% 55.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV