Transcript: Human XM_011526842.1

PREDICTED: Homo sapiens WD repeat domain 62 (WDR62), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR62 (284403)
Length:
3194
CDS:
109..3111

Additional Resources:

NCBI RefSeq record:
XM_011526842.1
NBCI Gene record:
WDR62 (284403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243235 CCAAGAAGCCCTCGACCTTTA pLKO_005 2823 CDS 100% 10.800 15.120 N WDR62 n/a
2 TRCN0000243236 GTTCGGATGGACTACACTTTG pLKO_005 377 CDS 100% 10.800 15.120 N WDR62 n/a
3 TRCN0000243237 AGGACCTGGATTGCTACTTTA pLKO_005 1178 CDS 100% 13.200 9.240 N WDR62 n/a
4 TRCN0000172467 CAACTGCATGAAGCAGCACTT pLKO.1 786 CDS 100% 4.050 2.835 N WDR62 n/a
5 TRCN0000167930 CCATCCAAAGATAGCTTGGAT pLKO.1 982 CDS 100% 0.300 0.210 N WDR62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16147 pDONR223 0% 62.8% 62.7% None (many diffs) n/a
2 ccsbBroad304_16147 pLX_304 0% 62.8% 62.7% V5 (many diffs) n/a
3 TRCN0000473808 ATTACGGCGATGCACCGGATTGTA pLX_317 10.2% 62.8% 62.7% V5 (many diffs) n/a
Download CSV