Transcript: Human XM_011526993.3

PREDICTED: Homo sapiens CCR4-NOT transcription complex subunit 3 (CNOT3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNOT3 (4849)
Length:
2527
CDS:
296..2344

Additional Resources:

NCBI RefSeq record:
XM_011526993.3
NBCI Gene record:
CNOT3 (4849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015135 CGAGGAGAACGAGTTTCTCTA pLKO.1 955 CDS 100% 0.495 0.693 N CNOT3 n/a
2 TRCN0000015137 TGGAGCAGTTTGAAGATATTT pLKO.1 360 CDS 100% 15.000 10.500 N CNOT3 n/a
3 TRCN0000419474 AGCTGTCAGAGGTGAACATAC pLKO_005 2058 CDS 100% 10.800 7.560 N CNOT3 n/a
4 TRCN0000095855 GCAAGCTCATTGAGACGCAAA pLKO.1 537 CDS 100% 4.050 2.835 N Cnot3 n/a
5 TRCN0000323578 GCAAGCTCATTGAGACGCAAA pLKO_005 537 CDS 100% 4.050 2.835 N Cnot3 n/a
6 TRCN0000015134 GCAGCTTATAGACAACCGCAA pLKO.1 520 CDS 100% 2.160 1.512 N CNOT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06648 pDONR223 100% 90.2% 90% None (many diffs) n/a
2 ccsbBroad304_06648 pLX_304 0% 90.2% 90% V5 (many diffs) n/a
3 TRCN0000474579 TTCGTTGTACTGGATTTCGGACTC pLX_317 22.5% 90.2% 90% V5 (many diffs) n/a
Download CSV